19+ puc-gw-kan vector
KP826769-KP826773 for Agrobacterium-mediated plant transformation. The final construct is verified with both Sanger DNA sequencing on at least one strand and.
Plasmid Maps Of P4d5 8rfp Used To Clone And Express Red Fluorescent Download Scientific Diagram
PUC vectors used as cloning vectors and they Senin 31 Oktober.

. The PC-GW vectors use the. The designation pUC is derived from the classical p prefix denoting plasmid and the. The molecular weight of the pUC19 vector is 17510 6 Da.
With twenty years of gene synthesis and custom cloning experience we can clone into any vector. Gain unparalleled visibility of your plasmids DNA and protein. Vector database is a digital collection of vector backbones assembled from publications and commercially available sources.
SnapGene Viewer is free software that allows molecular biologists to create browse and share richly annotated sequence files. M13F 47 M13 XapI SacI KpnI Bsp68I 5 C GCC AGG GTT T T C CCA GTC ACG ACG T T G TAA AAC GAC GGC CAG AGA ATT CGA GCT CGG. Advantages of pUC vector.
This is a free resource for the scientific community that is. High copy number 500-600 copies per cell. It is a small plasmid with a.
Pathways ORFs. 1 pUC57Kan Vector Map Multiple Cloning Sites. PUC-GW-Kan Search Vector Database.
Pathway ORF Kits. These plasmids are 2700 bp long and contains. PUC vectors used as cloning vectors and they belong to pUC series named after the place of their initial preparation ie.
PUC19 is 2686 bp in length. It is a commonly used cloning vector in the bacteria E. The designation pUC is derived from the classical p prefix denoting plasmid and the.
19 puc-gw-kan vector. Eurofins Genomics Blue Heron provides several vector options for your convenience. S8 dq 6htxhqfh es 777777777777 77777777777.
Many restriction sites in MCS Multiple Cloning Sites Disadvantage. Puc-gw-kan sequence 2626bp tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagactgtcacagcttgtctgtaagcggatgccg. Easy one step selection of recombinant colonies.
We have developed a novel binary vector series named the PC-GW series GenBank. PUC19 is one of a series of plasmid cloning vectors created by Joachim Messing and co-workers. The assembled full-length gene is cloned into the pUC-GW-KanAmp vector via the EcoRV site.
19 Puc Gw Kan Vector Kerianruaidhri
Puc19 Vector From New England Biolabs Biocompare Com
19 Puc Gw Kan Vector Kerianruaidhri
Addgene Puc19
Puc19 Vector And Its Features Usefulness In Cloning Youtube
Restriction Site Free Cloning Rsfc Plasmid Family For Seamless Sequence Independent Cloning In Pichia Pastoris Microbial Cell Factories Full Text
Puc19 Vector And Its Features Usefulness In Cloning Youtube
Addgene Pzcs16 Peft 3 Wrmscarlet Tbb 2 3 Utr In Puc19
3 Diagram Of Puc19 And Its Corresponding Multiple Cloning Site Download Scientific Diagram
Addgene Plenti6 Ubc Mslc7a1
Addgene Pfl V5 Gw
19 Puc Gw Kan Vector Kerianruaidhri
Addgene Tgt His
Cloning Vector Puc19 Pdf Vector Molecular Biology Molecular Cloning
19 Puc Gw Kan Vector Kerianruaidhri
Addgene Pcdna3 Dn Hcul4a Flag
Addgene Pzcs16 Peft 3 Wrmscarlet Tbb 2 3 Utr In Puc19